Transcript #00016873 (NM_000311.3, PRNP gene)

Transcript name transcript variant 1
Gene name PRNP (prion protein)
Chromosome 20
Transcript - NCBI ID NM_000311.3
Transcript - Ensembl ID -
Protein - NCBI ID NP_000302.1
Protein - Ensembl ID -
Protein - Uniprot ID -
Exon/intron information Exon/intron information table: HTML, Txt
Remarks -


Variants

162 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Affects function     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Haplotype     
-/. - c.-10-21G>A r.(=) p.(=) -
-/? 1i c.-10-21G>A r.(?) p.(=) -
-/? 1i c.-10-21G>A r.(?) p.(=) -
-/? 1i c.-10-21G>A r.(?) p.(=) -
-?/. - c.159C>T r.(?) p.(Gly53=) -
-?/. 2 c.160G>A r.(?) p.(Gly54Ser) -
-?/. 2 c.160G>A r.(?) p.(Gly54Ser) -
+/. 2 c.160G>A r.(?) p.(Gly54Ser) -
?/. - c.160G>A r.(?) p.(Gly54Ser) -
-?/? 2 c.(178_201)[3] r.(?) p.(Pro60_Gln67)[3] -
+?/. 2 c.201_202ins(168) r.(?) p.(Pro60_Gln67)[11] 12
+?/. 2 c.201_202ins(216) r.(?) p.(Pro60_Gln67)[13] 14
+?/. 2 c.203_204ins204_227{222G>A}ins180_251{246A>G}ins204_227 r.(?) p.(Pro60_Gln67)[9] 10
+?/. 2 c.203_204ins228_251ins204_251ins204_251{246A>G} r.(?) p.(Pro60_Gln67)[9] 10
+?/. 2 c.203_204ins228_251ins204_251ins204_251{246A>G} r.(?) p.(Pro60_Gln67)[9] 10
-?/. - c.204T>C r.(?) p.(Pro68=) -
-?/. - c.204T>C r.(?) p.(Pro68=) -
?/? 2 c.(204_227)del r.(?) p.(Pro84_Gln91)del -
?/? 2 c.(204_227)del r.(?) p.(Pro84_Gln91)del -
-/? 2 c.204_227del r.(?) p.(Pro84_Gln91)del -
-?/? 2 c.204_227del r.(?) p.(Pro84_Gln91)del -
-/? 2 c.204_227del r.(?) p.(Pro84_Gln91)del -
-/. - c.204_227del r.(?) p.(Pro84_Gln91del) -
-/. - c.204_227del r.(?) p.(Pro84_Gln91del) -
-?/. 2 c.204_227dup r.(?) p.(Pro84_Gln91dup) -
+?/. 2 c.210T>C r.(?) p.(=) -
+/? 2 c.210T>C r.(?) p.(=) -
+?/. 2 c.225_226ins204_227[4] r.(?) p.(Pro60_Gln67)[8] 9
+/? 2 c.225_226ins204_251ins204_251ins204_251{246A>G}ins228_251 r.(?) p.(Pro60_Gln67)[11] -
+?/. 2 c.225_226ins204_251ins204_251{246A>G}ins180_227 r.(?) p.(Pro60_Gln67)[10] 11
+/. 2 c.225_226ins204_251ins204_251{246A>G}ins180_227 r.(?) p.(Pro60_Gln67)[10] 11
+?/? 2 c.225_226ins204_251[2]ins204_251{246G>A}ins228_251 r.(?) p.(Pro60_Gln67)[11] 12
+?/. 2 c.225_226ins228_251{246A>G}ins204_227[4] r.(?) p.(Pro60_Gln67)[9] 10
+?/. 2 c.225_226ins228_251{246A>G}ins204_227[4] r.(?) p.(Pro60_Gln67)[9] 10
+/? 2 c.225_226ins228_251{246A>G}ins228_251ins180_227ins180_227ins180_227 r.(?) p.(Pro60_Gln67)[12] -
+/. 2 c.225_226ins228_251{246A>G}[3]ins180_251 r.(?) p.(Pro60_Gln67)[9] 10
+/. - c.227_228ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]] r.227_228ins[ucauggugguggcugggggcagcc[2];ccauggugguggcuggggacagcc;ucauggugguggcugggggcagcc[5]] p.(Gln91_Gly92insProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGln) -
-/. - c.228_251del r.(?) p.(Pro84_Gln91del) -
-?/? 2 c.246_269del r.(?) p.(Pro60_Gln67)[3] -
-/? 2 c.246_269del r.(?) p.(Pro60_Gln67)[4] -
-/? 2 c.246_269del r.(?) p.(Pro60_Gln67)[4] -
-?/? 2 c.246_269del r.(?) p.(Pro84_Gln91)del -
-?/? 2 c.246_269del r.(?) p.(Pro84_Gln91)del -
-/. - c.246_269del r.(?) p.(Pro84_Gln91del) -
+?/. 2 c.249_250ins180_227ins180_227ins180_227ins180_227{222G>A} r.(?) p.(Pro60_Gln67)[12] 13
+/. 2 c.249_250ins180_227ins180_251 r.(?) p.(Pro60_Gln67)[9] 10
+/? 2 c.249_250ins180_227ins204_251{246A>G}ins180_227ins204_251 r.(?) p.(Pro60_Gln67)[12] -
+/. 2 c.249_250ins180_227ins204_251{246A>G}ins180_251 r.(?) p.(Pro60_Gln67)[11] 12
+?/? 2 c.249_250ins204_227{222G>A}ins204_227{222G>A} r.(?) p.(Pro60_Gln67)[6] -
+?/. 2 c.249_250ins204_251ins204_251 r.(?) p.(Pro60_Gln67)[8] 9
+/? 2 c.249_250ins204_251ins228_251{246A>G}ins180_227{222G>A}ins204_251ins204_251 r.(?) p.(Pro60_Gln67)[13] -
+?/? 2 c.249_250ins204_251{246A>G}ins180_251 r.(?) p.(Pro60_Gln67)[9] 10
+?/. 2 c.249_250ins204_251{246A>G}ins180_251 r.(?) p.(Pro60_Gln67)[9] 10
+?/. 2 c.249_250ins204_251{246A>G}ins180_251 r.(?) p.(Pro60_Gln67)[9] 10
+/? 2 c.249_250ins204_251{246A>G}ins204_227{222G>A}ins180_227ins204_251{246A>G}ins204_251 r.(?) p.(Pro60_Gln67)[13] -
?/? 2 c.290G>A r.(?) p.(Ser97Asn) -
+/. 2 c.305C>T r.(?) p.(Pro102Leu) -
+/? 2 c.305C>T r.(?) p.(Pro102Leu) -
+/? 2 c.305C>T r.(?) p.(Pro102Leu) -
+/? 2 c.305C>T r.(?) p.(Pro102Leu) -
+/. 2 c.305C>T r.(?) p.(Pro102Leu) -
+/? 2 c.305C>T r.(?) p.(Pro102Leu) -
+/? 2 c.305C>T r.(?) p.(Pro102Leu) -
+/? 2 c.314C>T r.(?) p.(Pro105Leu) -
+/? 2 c.314C>T r.(?) p.(Pro105Leu) -
?/? 2 c.314C>T r.(?) p.(Pro105Leu) -
+/. 2 c.314C>T r.(?) p.(Pro105Leu) -
+/. 2 c.314C>T r.(?) p.(Pro105Leu) -
+/. - c.314C>T r.(?) p.(Pro105Leu) -
+/. - c.314C>T r.(?) p.(Pro105Leu) -
+/? 2 c.314C>T r.(?) p.(Pro105Leu) -
+/? 2 c.314C>T r.(?) p.(Pro105Leu) -
+/? 2 c.314C>T r.(?) p.(Pro105Leu) -
+?/. 2 c.341G>T r.(?) p.(Gly114Val) -
+?/. 2 c.341G>T r.(?) p.(Gly114Val) -
-/? 2 c.350C>T r.(?) p.(Ala117Val) -
-/? 2 c.350C>T r.(?) p.(Ala117Val) -
+/. 2 c.350_351inv r.(?) p.(Ala117Val) -
+/? 2 c.350_351inv r.(?) p.(Ala117Val) -
-/? 2 c.351A>G r.(?) p.(=) -
-/. - c.351A>G r.(?) p.(Ala117=) -
-/. - c.351A>G r.(?) p.(Ala117=) -
-/. - c.351A>G r.(?) p.(Ala117=) -
-/? 2 c.351A>G r.(?) p.(=) -
-/? 2 c.351A>G r.(?) p.(=) -
-/? 2 c.351A>G r.(?) p.(=) -
-/? 2 c.372C>G r.(?) p.(=) -
-?/. - c.372C>G r.(?) p.(Gly124=) -
-?/. - c.372C>G r.(?) p.(Gly124=) -
-/? 2 c.372C>G r.(?) p.(=) -
-/. - c.385A>G r.(?) p.(Met129Val) -
-?/? 2 c.385A>G r.(?) p.(Met129Val) -
-?/? 2 c.385A>G r.(?) p.(Met129Val) -
-/? 2 c.385A>G r.(?) p.(Met129Val) -
-/? 2 c.385A>G r.(?) p.(Met129Val) -
-/? 2 c.385A>G r.(?) p.(Met129Val) -
-/? 2 c.385A>G r.(?) p.(Met129Val) -
?/? 2 c.385A>G r.(?) p.(Met129Val) -
-/. - c.385A>G r.(?) p.(Met129Val) -
-/. - c.385A>G r.(?) p.(Met129Val) -
Legend   How to query   « First ‹ Prev     1 2     Next › Last »