Transcript #00022978 (NM_001005404.3, YPEL2 gene)

Transcript name yippee-like 2 (Drosophila)
Gene name YPEL2 (yippee-like 2 (Drosophila))
Chromosome 17
Transcript - NCBI ID NM_001005404.3
Transcript - Ensembl ID -
Protein - NCBI ID NP_001005404.1
Protein - Ensembl ID -
Protein - Uniprot ID -
Exon/intron information Exon/intron information table: HTML, Txt
Remarks -
Date created 0000-00-00 00:00:00 +00:19 (LMT)
Date last edited N/A


Variants

30 entries on 1 page. Showing entries 1 - 30.
Legend   How to query  

Affects function     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     
+/. - c.-163923_-163922ins[TGTTGTTGCCTTGTTTCCTGGG;-163923_118-4766;117+9471_*141947] r.? p.?
?/. - c.-111538_*147432dup r.0 p.0
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
+/. - c.? r.? p.?
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.