Transcript #00023827 (NM_001042472.2, ABHD12 gene)

Transcript name transcript variant 1
Gene name ABHD12 (abhydrolase domain containing 12)
Chromosome 20
Transcript - NCBI ID NM_001042472.2
Transcript - Ensembl ID -
Protein - NCBI ID NP_001035937.1
Protein - Ensembl ID -
Protein - Uniprot ID -
Exon/intron information Exon/intron information table: HTML, Txt
Remarks -


Variants

107 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Affects function     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     
+/. _1_1i c.-28544_192-20684delins[GTTAAGTTAAGTGTTGGGTTAAGTTAAGTTTCTT;NM_021067.3:75+2104_75+2166] r.0? p.0?
+/. _1_1i c.-6920_191+6897del r.0? p.0?
+/. _1_1i c.-6920_191+6897del r.0? p.0?
+/. _1_1i c.-6920_191+6897del r.0? p.0?
-/. - c.-40_-39insGGCGGAGGC r.(?) p.(=)
?/. - c.103C>T r.(?) p.(Arg35Cys)
?/. - c.103C>T r.(?) p.(Arg35Cys)
-/. - c.129G>A r.(?) p.(Thr43=)
-?/. - c.129G>A r.(?) p.(Thr43=)
-?/. - c.135G>A r.(?) p.(Pro45=)
?/. - c.182C>A r.(?) p.(Ala61Glu)
-/. - c.189C>G r.(?) p.(Gly63=)
?/. - c.189C>G r.(?) p.(Gly63=)
-?/. - c.191+7_191+10del r.(=) p.(=)
-?/. - c.191+7_191+14del r.(=) p.(=)
-/. - c.191+14C>G r.(=) p.(=)
-/. - c.191+17A>G r.(=) p.(=)
-/. - c.191+17_191+19del r.(=) p.(=)
-/. - c.191+19C>G r.(=) p.(=)
-?/. - c.191+19del r.(=) p.(=)
-?/. - c.191+36_191+37insGGGGGGGGGGGGGGGG r.(=) p.(=)
-?/. - c.191+36_191+37insGGGGGGGGGGGGGGGGGGGGG r.(=) p.(=)
+/. - c.193C>T r.(?) p.(Arg65*)
-/. - c.202G>A r.(?) p.(Val68Met)
-/. - c.202G>A r.(?) p.(Val68Met)
-?/. - c.203T>C r.(?) p.(Val68Ala)
?/. - c.203T>C r.(?) p.(Val68Ala)
?/. - c.212G>A r.(?) p.(Arg71His)
-?/. - c.268A>G r.(?) p.(Ile90Val)
-?/. - c.296A>G r.(?) p.(Lys99Arg)
+/. 2i c.316+2T>A r.spl p.?
+/. 2i c.316+2T>A r.spl p.?
-/. - c.317-5T>C r.spl? p.?
+?/. - c.317-2A>G r.spl? p.?
+/. - c.319del r.(?) p.(Arg107Glufs*8)
+/. - c.319del r.(?) p.(Arg107Glufs*8)
+/. - c.319del r.(?) p.(Arg107Glufs*8)
+/. - c.319del r.(?) p.(Arg107Glufs*8)
+/. - c.337_338del r.(?) p.(Asp113PhefsTer14)
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT r.(?) p.(Asp113Phefs*15)
+?/. - c.337_338delinsTTT r.(?) p.(Asp113Phefs*15)
?/. - c.344A>T r.(?) p.(Lys115Ile)
+?/. 3 c.379_385delins[GA;317-82_317-40inv] r.(?) p.(Asn127Aspfs*23)
-?/. - c.405C>T r.(?) p.(Asp135=)
?/. - c.430G>A r.(?) p.(Val144Ile)
+/. - c.447G>A r.(?) p.(Trp159*)
-/. - c.453C>T r.(?) p.(Asn151=)
+/. - c.477G>A r.(?) p.(Trp159Ter)
-?/. - c.540C>T r.(?) p.(Thr180=)
?/. - c.556C>T r.(?) p.(Arg186Cys)
?/. - c.557G>C r.(?) p.(Arg186Pro)
+/. - c.557G>C r.(?) p.(Arg186Pro)
?/. - c.578T>A r.(?) p.(Leu193Gln)
+/. - c.605C>T r.(?) p.(Thr202Ile)
+/. - c.605C>T r.(?) p.(Thr202Ile)
+/. - c.605C>T r.(?) p.(Thr202Ile)
+/. - c.605C>T r.(?) p.(Thr202Ile)
?/. - c.750-2A>G r.spl? p.?
+/. 8 c.758C>G r.(?) p.(Thr253Arg)
?/. - c.769C>T r.(?) p.(Arg257Trp)
?/. - c.769C>T r.(?) p.(Arg257Trp)
?/. - c.769C>T r.(?) p.(Arg257Trp)
?/. - c.769C>T r.(?) p.(Arg257Trp)
?/. - c.769C>T r.(?) p.(Arg257Trp)
-?/. - c.787+3G>A r.spl? p.?
-?/. - c.788-10_788-7del r.(=) p.(=)
-/. - c.837C>T r.(?) p.(Arg279=)
-/. - c.837C>T r.(?) p.(Arg279=)
-/. - c.837C>T r.(?) p.(Arg279=)
+/. 9 c.846_852dup r.(?) p.(His285*)
+/. 9 c.846_852dup r.(?) p.(His285*)
+/. 9 c.846_852dup r.(?) p.(His285*)
+/. 9 c.846_852dup r.(?) p.(His285*)
+/. 9 c.846_852dup r.(?) p.(His285*)
+/. 9 c.846_852dup r.(?) p.(His285*)
+/. 9 c.846_852dup r.(?) p.(His285*)
-?/. - c.867+9A>C r.(=) p.(=)
-?/. - c.951-9C>T r.(=) p.(=)
?/. - c.983T>C r.(?) p.(Leu328Pro)
-/. - c.1045G>A r.(?) p.(Ala349Thr)
+/. 12 c.1054C>T r.(?) p.(Arg352*)
-/. - c.1068T>C r.(?) p.(Asp356=)
-/. - c.1068T>C r.(?) p.(Asp356=)
+/. - c.1075del r.(?) p.(Val359PhefsTer27)
+/. - c.1075del r.(?) p.(Val359PhefsTer27)
-?/. - c.1113G>A r.(?) p.(Arg371=)
+/. - c.1116C>G r.(?) p.(His372Gln)
+?/. 12 c.1129A>T r.1129a>u p.Lys377*
-?/. - c.1157+3G>A r.spl? p.?
-?/. - c.1176G>A r.(?) p.(Ser392=)
?/. - c.*13G>T r.(=) p.(=)
-?/. - c.*454G>A r.(=) p.(=)
-?/. - c.*454G>A r.(=) p.(=)
Legend   How to query   « First ‹ Prev     1 2     Next › Last »