Transcript #00023827

Transcript name transcript variant 1
Gene name ABHD12 (abhydrolase domain containing 12)
Chromosome 20
Transcript - NCBI ID NM_001042472.2
Transcript - Ensembl ID -
Protein - NCBI ID NP_001035937.1
Protein - Ensembl ID -
Protein - Uniprot ID -
Exon/intron information Exon/intron information table: HTML, Txt
Remarks -


Variants

105 entries on 2 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2     Next › Last »

Affects function     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     
+/. _1_1i c.-28544_192-20684delins[GTTAAGTTAAGTGTTGGGTTAAGTTAAGTTTCTT;NM_021067.3:75+2104_75+2166] - r.0? p.0?
+/. _1_1i c.-6920_191+6897del - r.0? p.0?
+/. _1_1i c.-6920_191+6897del - r.0? p.0?
+/. _1_1i c.-6920_191+6897del - r.0? p.0?
-/. - c.-40_-39insGGCGGAGGC benign r.(?) p.(=)
?/. - c.103C>T VUS r.(?) p.(Arg35Cys)
-/. - c.129G>A benign r.(?) p.(=)
-?/. - c.129G>A likely benign r.(?) p.(=)
-?/. - c.135G>A likely benign r.(?) p.(=)
?/. - c.182C>A VUS r.(?) p.(Ala61Glu)
-/. - c.189C>G benign r.(?) p.(=)
?/. - c.189C>G VUS r.(?) p.(=)
-?/. - c.191+7_191+10del likely benign r.(=) p.(=)
-?/. - c.191+7_191+14del likely benign r.(=) p.(=)
-/. - c.191+14C>G benign r.(=) p.(=)
-/. - c.191+17A>G benign r.(=) p.(=)
-/. - c.191+17_191+19del benign r.(=) p.(=)
-/. - c.191+19C>G benign r.(=) p.(=)
-?/. - c.191+19del likely benign r.(=) p.(=)
-?/. - c.191+36_191+37insGGGGGGGGGGGGGGGG likely benign r.(=) p.(=)
-?/. - c.191+36_191+37insGGGGGGGGGGGGGGGGGGGGG likely benign r.(=) p.(=)
+/. - c.193C>T - r.(?) p.(Arg65*)
-/. - c.202G>A benign r.(?) p.(Val68Met)
-/. - c.202G>A benign r.(?) p.(Val68Met)
?/. - c.203T>C VUS r.(?) p.(Val68Ala)
?/. - c.212G>A VUS r.(?) p.(Arg71His)
-?/. - c.268A>G likely benign r.(?) p.(Ile90Val)
-?/. - c.296A>G likely benign r.(?) p.(Lys99Arg)
+/. 2i c.316+2T>A - r.spl p.?
+/. 2i c.316+2T>A - r.spl p.?
-/. - c.317-5T>C benign r.spl? p.?
+?/. - c.317-2A>G likely pathogenic r.spl? p.?
+/. - c.319del - r.(?) p.(Arg107Glufs*8)
+/. - c.319del - r.(?) p.(Arg107Glufs*8)
+/. - c.319del - r.(?) p.(Arg107Glufs*8)
+/. - c.319del - r.(?) p.(Arg107Glufs*8)
+/. - c.337_338del pathogenic r.(?) p.(Asp113Phefs*14)
+/. 3 c.337_338delinsTTT - r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT - r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT - r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT - r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT - r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT - r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT - r.(?) p.(Asp113Phefs*15)
+/. 3 c.337_338delinsTTT - r.(?) p.(Asp113Phefs*15)
?/. - c.344A>T VUS r.(?) p.(Lys115Ile)
+?/. 3 c.379_385delins[GA;317-82_317-40inv] - r.(?) p.(Asn127Aspfs*23)
?/. - c.430G>A VUS r.(?) p.(Val144Ile)
+/. - c.447G>A - r.(?) p.(Trp159*)
-/. - c.453C>T benign r.(?) p.(=)
+/. - c.477G>A pathogenic r.(?) p.(Trp159*)
-?/. - c.540C>T likely benign r.(?) p.(=)
?/. - c.556C>T VUS r.(?) p.(Arg186Cys)
?/. - c.557G>C VUS r.(?) p.(Arg186Pro)
+/. - c.557G>C - r.(?) p.(Arg186Pro)
?/. - c.578T>A VUS r.(?) p.(Leu193Gln)
+/. - c.605C>T - r.(?) p.(Thr202Ile)
+/. - c.605C>T - r.(?) p.(Thr202Ile)
+/. - c.605C>T - r.(?) p.(Thr202Ile)
+/. - c.605C>T - r.(?) p.(Thr202Ile)
?/. - c.750-2A>G VUS r.spl? p.?
+/. 8 c.758C>G - r.(?) p.(Thr253Arg)
?/. - c.769C>T VUS r.(?) p.(Arg257Trp)
?/. - c.769C>T VUS r.(?) p.(Arg257Trp)
?/. - c.769C>T VUS r.(?) p.(Arg257Trp)
-?/. - c.788-10_788-7del likely benign r.(=) p.(=)
-/. - c.837C>T benign r.(?) p.(=)
-/. - c.837C>T benign r.(?) p.(=)
-/. - c.837C>T benign r.(?) p.(=)
+/. 9 c.846_852dup - r.(?) p.(His285*)
+/. 9 c.846_852dup - r.(?) p.(His285*)
+/. 9 c.846_852dup - r.(?) p.(His285*)
+/. 9 c.846_852dup - r.(?) p.(His285*)
+/. 9 c.846_852dup - r.(?) p.(His285*)
+/. 9 c.846_852dup - r.(?) p.(His285*)
+/. 9 c.846_852dup - r.(?) p.(His285*)
-?/. - c.867+9A>C likely benign r.(=) p.(=)
-?/. - c.951-9C>T likely benign r.(=) p.(=)
?/. - c.983T>C VUS r.(?) p.(Leu328Pro)
-/. - c.1045G>A benign r.(?) p.(Ala349Thr)
+/. 12 c.1054C>T - r.(?) p.(Arg352*)
-/. - c.1068T>C benign r.(?) p.(=)
-/. - c.1068T>C benign r.(?) p.(=)
+/. - c.1075del pathogenic r.(?) p.(Val359Phefs*27)
+/. - c.1075del pathogenic r.(?) p.(Val359Phefs*27)
-?/. - c.1113G>A likely benign r.(?) p.(=)
+/. - c.1116C>G - r.(?) p.(His372Gln)
+?/. 12 c.1129A>T - r.1129a>u p.Lys377*
-?/. - c.1157+3G>A likely benign r.spl? p.?
-?/. - c.1176G>A likely benign r.(?) p.(=)
?/. - c.*13G>T VUS r.(=) p.(=)
-/. - c.*5860A>G benign r.(=) p.(=)
-/. - c.*5860A>G benign r.(=) p.(=)
-?/. - c.*5863G>A likely benign r.(=) p.(=)
-/. - c.*5864C>T benign r.(=) p.(=)
-?/. - c.*5879C>T likely benign r.(=) p.(=)
-?/. - c.*8330C>G likely benign r.(=) p.(=)
-?/. - c.*8332T>G likely benign r.(=) p.(=)
-?/. - c.*8360C>G likely benign r.(=) p.(=)
?/. - c.*8361A>C VUS r.(=) p.(=)
Legend   « First ‹ Prev     1 2     Next › Last »