Variant #0000016151 (NC_000009.11:g.35658024_35658025insTCAGCTTCACAGAGTACTTCACAGAGTA, NR_003051.3:n.-10_-9insTACTCTGTGAAGTACTCTGTGAAGCTGA (RMRP))
| Chromosome |
9 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Affects function |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.35658024_35658025insTCAGCTTCACAGAGTACTTCACAGAGTA |
| DNA change (hg38) |
g.35658027_35658028insTCAGCTTCACAGAGTACTTCACAGAGTA |
| Published as |
insertion TACTCTGTGAAGTACTCTGTGAAGCTGA at -10 (including 2 times duplication) |
| ISCN |
- |
| DB-ID |
RMRP_000003 |
| Variant remarks |
1 CHH patient |
| Reference |
PubMed: Roifman et al. 2006 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
SUMMARY record |
| Segregation |
yes |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Anne Polvi |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Anne Polvi |
| Date created |
2012-11-05 09:48:46 +01:00 (CET) |
| Date last edited |
2017-05-05 19:04:32 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|