Variant #0000019239 (NC_000020.10:g.25340671_25399883delins[25390635_25390697;AAGAAACTTAACTTAACCCAACACTTAACTTAAC], ABHD12(NM_001042472.2):c.-28544_192-20684delins[GTTAAGTTAAGTGTTGGGTTAAGTTAAGTTTCTT;NM_021067.3:75+2104_75+2166])

Individual ID 00001632
Chromosome 20
Allele Maternal (confirmed)
Affects function (as reported) Affects function
Affects function (by curator) Not classified
Classification method -
Clinical classification pathogenic
DNA change (genomic) (Relative to hg19 / GRCh37) g.25340671_25399883delins[25390635_25390697;AAGAAACTTAACTTAACCCAACACTTAACTTAAC]
DNA change (hg38) g.25360035_25419247delins[25409999_25410061;AAGAAACTTAACTTAACCCAACACTTAACTTAAC]
Published as 1-192_oGINS1:c.327+1052del
ISCN -
DB-ID ABHD12_000005
Variant remarks 59 kb deletion
Reference PubMed: Chen 2013
ClinVar ID -
dbSNP ID -
Origin Germline
Segregation yes
Frequency -
Re-site -
VIP 0
Methylation -
Average frequency (gnomAD v.2.1.1) Variant not found in online data sets
Owner Dong-Hui Chen
Database submission license No license selected
Created by Dong-Hui Chen
Options




Variant on transcripts


Gene     

AscendingTranscript     

Affects function     

Exon     

DNA change (cDNA)     

RNA change     

Protein     
ABHD12 NM_001042472.2 +/. _1_1i c.-28544_192-20684delins[GTTAAGTTAAGTGTTGGGTTAAGTTAAGTTTCTT;NM_021067.3:75+2104_75+2166] r.0? p.0?
GINS1 NM_021067.3 +/. _1_4i c.-47786_330+1052delins[75+2104_75+2166;GTTAAGTTAAGTGTTGGGTTAAGTTAAGTTTCTT] r.0? p.0?



Screenings


AscendingScreening ID     

Template     

Technique     

Tissue     

Remarks     

Genes screened     

Variants found     

Owner     
0000001442 DNA;RNA arrayCGH;arrayCNV;PCR;PCRlr;PCRq;RT-PCR;SEQ;TaqMan;Western - - ABHD12 1 Dong-Hui Chen