Variant #0000087570 (NC_000006.11:g.51524421_51524443del, NM_138694.3:c.10481_10503del (PKHD1))
| Individual ID |
00057351 |
| Chromosome |
6 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.51524421_51524443del |
| DNA change (hg38) |
g.51659623_51659645del |
| Published as |
10481_10503delTTCTCTTGGCTGTATTCTACCAT |
| ISCN |
- |
| DB-ID |
PKHD1_000731 |
| Variant remarks |
combination of variants not reported |
| Reference |
PubMed: Bergmann 2003 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Johan den Dunnen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2016-01-23 03:23:58 +01:00 (CET) |
| Date last edited |
2025-10-04 15:35:06 +02:00 (CEST) |

Variant on transcripts
Screenings
|