Variant #0000140596 (NC_000001.10:g.150526234_150526253del, NM_019032.4:c.767_786del (ADAMTSL4))
| Individual ID |
00088068 |
| Chromosome |
1 |
| Allele |
Both (homozygous) |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Affects function |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.150526234_150526253del |
| DNA change (hg38) |
g.150553758_150553777del |
| Published as |
c.767_786delAGGCCTCTGGCACAGAGCCC; p.(Gln256ProfsX38) |
| ISCN |
- |
| DB-ID |
ADAMTSL4_000001 See all 18 reported entries |
| Variant remarks |
- |
| Reference |
PubMed: Neuhann 2011 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Andreas Laner |
| Database submission license |
Creative Commons Attribution 4.0 International |
| Created by |
Andreas Laner |
| Date created |
2014-10-13 16:47:09 +02:00 (CEST) |
| Date last edited |
2014-10-15 09:40:48 +02:00 (CEST) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|