Variant #0000149576 (NC_000002.11:g.228029482_228029505del, NM_000091.4:c.40_63del (COL4A3))
| Individual ID |
00091303 |
| Chromosome |
2 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Probably affects function |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.228029482_228029505del |
| DNA change (hg38) |
g.227164766_227164789del |
| Published as |
40_63delCTGCCGCTCCTGCTGGTGCTCCTG (del LPLLLVLL) |
| ISCN |
- |
| DB-ID |
COL4A3_000003 See all 11 reported entries |
| Variant remarks |
Compound heterozygous |
| Reference |
PubMed: Tazon Vega 2003 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Judy Savige |
| Database submission license |
No license selected |
| Created by |
Judy Savige |
| Date created |
2011-01-05 13:35:21 +01:00 (CET) |
| Date last edited |
2025-03-08 22:05:32 +01:00 (CET) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|