Variant #0000224553 (NC_000005.9:g.155756573G>T, NM_000337.5:c.-14G>T (SGCD))
| Individual ID |
00133698 |
| Chromosome |
5 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.155756573G>T |
| DNA change (hg38) |
g.156329563G>T |
| Published as |
CCTGGTCCATTCACTCAACACTCC |
| ISCN |
- |
| DB-ID |
SGCD_000032 |
| Variant remarks |
- |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Kanchan Pathak |
| Database submission license |
No license selected |
| Created by |
Kanchan Pathak |
| Date created |
2009-04-16 14:25:38 +02:00 (CEST) |
| Date last edited |
2012-11-02 20:43:04 +01:00 (CET) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|