Variant #0000241343 (NC_000011.9:g.2466518_2466538del, NM_000218.2:c.190_210del (KCNQ1))
| Individual ID |
00147184 |
| Chromosome |
11 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.2466518_2466538del |
| DNA change (hg38) |
g.2445288_2445308del |
| Published as |
190_210delCCTGCGTCCCCGGCCGCGCCC |
| ISCN |
- |
| DB-ID |
KCNQ1_000761 |
| Variant remarks |
data from Inherited Arrhythmias web site |
| Reference |
PubMed: Kapplinger 2009 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Johan den Dunnen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Brenda Potrykus |
| Date created |
2010-12-22 12:00:00 +01:00 (CET) |
| Date last edited |
2018-01-02 19:33:02 +01:00 (CET) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|