Variant #0000244091 (NC_000009.11:g.27573498_27573520del, NC_000009.11(NM_001256054.1):c.-45+187_-45+209del (C9orf72))
| Individual ID |
00326107 |
| Chromosome |
9 |
| Allele |
Parent #1 |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Effect unknown |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.27573498_27573520del |
| DNA change (hg38) |
- |
| Published as |
g.26742_26764delGGGGCGTGGTCGGGGCGGGCCCG |
| ISCN |
- |
| DB-ID |
C9orf72_000012 |
| Variant remarks |
deletion of 23 bp in the low complexity sequence, upstream of exon 1 |
| Reference |
PubMed: van der Zee |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
1/27 expansion carrier patients |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Marc Cruts |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Julia Lopez |
| Date created |
2013-05-01 13:44:57 +02:00 (CEST) |
| Date last edited |
2021-01-07 23:21:32 +01:00 (CET) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|