Variant #0000244091 (NC_000009.11:g.27573498_27573520del, NC_000009.11(NM_001256054.1):c.-45+187_-45+209del (C9orf72))
Individual ID |
00326107 |
Chromosome |
9 |
Allele |
Parent #1 |
Affects function (as reported) |
Does not affect function |
Affects function (by curator) |
Effect unknown |
Classification method |
- |
Clinical classification |
benign |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.27573498_27573520del |
DNA change (hg38) |
- |
Published as |
g.26742_26764delGGGGCGTGGTCGGGGCGGGCCCG |
ISCN |
- |
DB-ID |
C9orf72_000012 |
Variant remarks |
deletion of 23 bp in the low complexity sequence, upstream of exon 1 |
Reference |
PubMed: van der Zee |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
Germline |
Segregation |
- |
Frequency |
1/27 expansion carrier patients |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
Marc Cruts |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
Julia Lopez |
Date created |
2013-05-01 13:44:57 +02:00 (CEST) |
Date last edited |
2021-01-07 23:21:32 +01:00 (CET) |

Variant on transcripts
Screenings
|