Variant #0000244098 (NC_000009.11:g.27573509_27573520del, NC_000009.11(NM_001256054.1):c.-45+187_-45+198del (C9orf72))
| Individual ID |
00326114 |
| Chromosome |
9 |
| Allele |
Parent #1 |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.27573509_27573520del |
| DNA change (hg38) |
- |
| Published as |
g.26747_26768delGTGGTCGGGGCGGGCCCGGGGG |
| ISCN |
- |
| DB-ID |
C9orf72_000005 |
| Variant remarks |
deletion of 22 bp in the low complexity sequence, upstream of exon 1 |
| Reference |
PubMed: van der Zee |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
1/57 expansion carrier patients |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Marc Cruts |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Julia Lopez |
| Date created |
2013-05-01 13:44:57 +02:00 (CEST) |
| Date last edited |
2021-01-08 17:44:31 +01:00 (CET) |

Variant on transcripts
Screenings
|