Variant #0000244098 (NC_000009.11:g.27573509_27573520del, NC_000009.11(NM_001256054.1):c.-45+187_-45+198del (C9orf72))
      
      
        
          | Individual ID | 
          00326114 |  
        
          | Chromosome | 
          9 |  
        
          | Allele | 
          Parent #1 |  
        
          | Affects function (as reported) | 
          Does not affect function |  
        
          | Affects function (by curator) | 
          Not classified |  
        
          | Classification method | 
          - |  
        
          | Clinical classification | 
          benign |  
        
          | DNA change (genomic) (Relative to hg19 / GRCh37) | 
          g.27573509_27573520del |  
        
          | DNA change (hg38) | 
          - |  
        
          | Published as | 
          g.26747_26768delGTGGTCGGGGCGGGCCCGGGGG |  
        
          | ISCN | 
          - |  
        
          | DB-ID | 
          C9orf72_000005 |  
        
          | Variant remarks | 
          deletion of 22 bp in the low complexity sequence, upstream of exon 1 |  
        
          | Reference | 
          PubMed: van der Zee |  
        
          | ClinVar ID | 
          - |  
        
          | dbSNP ID | 
          - |  
        
          | Origin | 
          Germline |  
        
          | Segregation | 
          - |  
        
          | Frequency | 
          1/57 expansion carrier patients |  
        
          | Re-site | 
          - |  
        
          | VIP | 
          - |  
        
          | Methylation | 
          - |  
        
          | Average frequency (gnomAD v.2.1.1) | 
          Retrieve |  
        
          | Owner | 
          Marc Cruts |  
        
          | Database submission license | 
          Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International   |  
        
          | Created by | 
          Julia Lopez |  
        
          | Date created | 
          2013-05-01 13:44:57 +02:00 (CEST) |  
        
          | Date last edited | 
          2021-01-08 17:44:31 +01:00 (CET) |   
        
      
      
      
  
      
       
      
  
      Variant on transcripts
      
      
       
      
      
  
      Screenings
       
      
     | 
   
 
 
 
    Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
    Use our  APIs to retrieve data.
  
 |