Variant #0000258304 (NC_000008.10:g.1806329_1806352del, NC_000008.10(NM_014629.2):c.193+48_193+71del (ARHGEF10))
| Chromosome |
8 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.1806329_1806352del |
| DNA change (hg38) |
g.1858163_1858186del |
| Published as |
ARHGEF10(NM_001308153.2):c.265+48_265+71delGGTGAGTCCCCAGGTGGGTCCCCA |
| ISCN |
- |
| DB-ID |
ARHGEF10_000005 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_AMC |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_AMC |
| Date created |
2018-01-15 20:58:59 +01:00 (CET) |
| Date last edited |
2020-03-23 16:13:27 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|