Variant #0000264367 (NC_000018.9:g.57115230_57115255del, NM_133459.3:c.735_760del (CCBE1))
| Chromosome |
18 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.57115230_57115255del |
| DNA change (hg38) |
g.59447998_59448023del |
| Published as |
CCBE1(NM_133459.4):c.735_760delTCCAGGACCTCCTGGCCTGCCTGGGG (p.P249Sfs*36) |
| ISCN |
- |
| DB-ID |
CCBE1_000012 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_AMC |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_AMC |
| Date created |
2018-01-15 20:58:59 +01:00 (CET) |
| Date last edited |
2020-07-14 19:13:52 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|