Variant #0000272895 (NC_000022.10:g.37964408_37964428del, NM_152243.2:c.757_777del (CDC42EP1))
| Chromosome |
22 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.37964408_37964428del |
| DNA change (hg38) |
g.37568401_37568421del |
| Published as |
CDC42EP1(NM_152243.3):c.757_777delCCAGCGCCTGCTGCAAACCCC (p.P253_P259del) |
| ISCN |
- |
| DB-ID |
CDC42EP1_000003 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
1.0E-5 View details |
| Owner |
VKGL-NL_Rotterdam |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Rotterdam |
| Date created |
2018-01-15 20:58:59 +01:00 (CET) |
| Date last edited |
2020-03-23 16:13:27 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|