Variant #0000274516 (NC_000023.10:g.120008804_120008830del, NM_001242922.1:c.*2693_*2719del (CT47A12))
| Chromosome |
X |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.120008804_120008830del |
| DNA change (hg38) |
g.120874950_120874976del |
| Published as |
CT47B1(NM_001145718.1):c.702_728delGAAGCTCACAGAGGAGGCCACAGAGGA (p.K235_E243del) |
| ISCN |
- |
| DB-ID |
CT47B1_000002 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Rotterdam |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Rotterdam |
| Date created |
2018-01-15 20:58:59 +01:00 (CET) |
| Date last edited |
2020-03-23 16:13:27 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|