Variant #0000281861 (NC_000017.10:g.38975327_38975353del, NM_000421.3:c.1443_1469del (KRT10))
Chromosome |
17 |
Allele |
Unknown |
Affects function (as reported) |
Probably does not affect function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
likely benign |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.38975327_38975353del |
DNA change (hg38) |
g.40819075_40819101del |
Published as |
KRT10(NM_000421.5):c.1443_1469delAAGCTCCGGCGGCGGCCACGGCGGCGG (p.S482_G490del) |
ISCN |
- |
DB-ID |
KRT10_000042 |
Variant remarks |
VKGL data sharing initiative Nederland |
Reference |
- |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
CLASSIFICATION record |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
0.00079 View details |
Owner |
VKGL-NL_Groningen |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
VKGL-NL_Groningen |
Date created |
2018-01-15 20:58:59 +01:00 (CET) |
Date last edited |
2023-01-11 15:44:22 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|