Variant #0000282356 (NC_000015.9:g.23892299_23892328del, NM_019066.4:c.609_638del (MAGEL2))
| Chromosome |
15 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.23892299_23892328del |
| DNA change (hg38) |
g.23647152_23647181del |
| Published as |
MAGEL2(NM_019066.4):c.609_638delCCCTCCGGGGACACCGATGGCTCATCCTCC (p.H221_A230del), MAGEL2(NM_019066.5):c.609_638delCCCTCCGGGGACACCGATGGCTCATCCTCC (p...) |
| ISCN |
- |
| DB-ID |
MAGEL2_000062 See all 3 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2018-01-15 20:58:59 +01:00 (CET) |
| Date last edited |
2021-09-17 14:40:49 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|