Variant #0000283365 (NC_000002.11:g.233712223_233712243del, KCNJ13(NM_002242.4):c.-71092_-71072del)

Chromosome 2
Allele Unknown
Affects function (as reported) Probably does not affect function
Affects function (by curator) Not classified
Classification method -
Clinical classification likely benign
DNA change (genomic) (Relative to hg19 / GRCh37) g.233712223_233712243del
DNA change (hg38) g.232847513_232847533del
Published as GIGYF2(NM_015575.3):c.3626_3646delTGCCACAGCAGCAGCAGCAGC (p.L1209_Q1215del)
DB-ID GIGYF2_000016 See all 2 reported entries
Variant remarks VKGL data sharing initiative Nederland
Reference -
ClinVar ID -
dbSNP ID -
Segregation -
Frequency -
Re-site -
Methylation -
Average frequency (large NGS studies) Variant not found in online data sets
Owner VKGL-NL_VUmc

Variant on transcripts



Affects function     


DNA change (cDNA)     

RNA change     

GIGYF2 NM_001103146.1 -?/. - c.3626_3646del r.(?) p.(Leu1209_Gln1215del)
KCNJ13 NM_002242.4 -?/. - c.-71092_-71072del r.(?) p.(=)