|   
  
    | Variant #0000299065 (NC_000002.11:g.105472214_105472235del, NM_006236.1:c.246_267del (POU3F3))
        
          | Chromosome | 2 |  
          | Allele | Unknown |  
          | Affects function (as reported) | Effect unknown |  
          | Affects function (by curator) | Not classified |  
          | Classification method | - |  
          | Clinical classification | VUS |  
          | DNA change (genomic) (Relative to hg19 / GRCh37) | g.105472214_105472235del |  
          | DNA change (hg38) | g.104855756_104855777del |  
          | Published as | POU3F3(NM_006236.3):c.246_267delGGCCGCCAGCAACGGCGGCCAT (p.M82Ifs*3) |  
          | ISCN | - |  
          | DB-ID | POU3F3_000001 See all 2 reported entries |  
          | Variant remarks | VKGL data sharing initiative Nederland |  
          | Reference | - |  
          | ClinVar ID | - |  
          | dbSNP ID | - |  
          | Origin | CLASSIFICATION record |  
          | Segregation | - |  
          | Frequency | - |  
          | Re-site | - |  
          | VIP | - |  
          | Methylation | - |  
          | Average frequency (gnomAD v.2.1.1) | Retrieve |  
          | Owner | VKGL-NL_VUmc |  
          | Database submission license | Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International   |  
          | Created by | VKGL-NL_VUmc |  
          | Date created | 2018-01-15 20:58:59 +01:00 (CET) |  
          | Date last edited | 2021-02-08 18:36:18 +01:00 (CET) |   
 
 
 
       
 
 Variant on transcripts
 |  
 
    Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
    Use our APIs  to retrieve data.
 |