Variant #0000299121 (NC_000020.10:g.4680070_4680093del, NM_000311.3:c.204_227del (PRNP))
| Chromosome |
20 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.4680070_4680093del |
| DNA change (hg38) |
g.4699424_4699447del |
| Published as |
PRNP(NM_000311.4):c.204_227delTCATGGTGGTGGCTGGGGGCAGCC (p.P84_Q91del), PRNP(NM_000311.5):c.204_227delTCATGGTGGTGGCTGGGGGCAGCC (p.P84_Q91del) |
| ISCN |
- |
| DB-ID |
PRNP_000057 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_VUmc |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_VUmc |
| Date created |
2018-01-15 20:58:59 +01:00 (CET) |
| Date last edited |
2023-01-11 15:44:22 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|