Variant #0000299123 (NC_000020.10:g.4680112_4680135del, NM_000311.3:c.246_269del (PRNP))
| Chromosome |
20 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.4680112_4680135del |
| DNA change (hg38) |
g.4699466_4699489del |
| Published as |
PRNP(NM_000311.5):c.246_269delACAGCCTCATGGTGGTGGCTGGGG (p.P84_Q91del), PRNP(NM_001080123.3):c.246_269delACAGCCTCATGGTGGTGGCTGGGG (p.P84_Q91del) |
| ISCN |
- |
| DB-ID |
PRNP_000059 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_VUmc |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_VUmc |
| Date created |
2018-01-15 20:58:59 +01:00 (CET) |
| Date last edited |
2023-04-16 21:50:28 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|