|   
  
    | Variant #0000299539 (NC_000005.9:g.176815132_176815160del, NM_003052.4:c.782_810del (SLC34A1))
        
          | Chromosome | 5 |  
          | Allele | Unknown |  
          | Affects function (as reported) | Probably affects function |  
          | Affects function (by curator) | Not classified |  
          | Classification method | - |  
          | Clinical classification | likely pathogenic |  
          | DNA change (genomic) (Relative to hg19 / GRCh37) | g.176815132_176815160del |  
          | DNA change (hg38) | g.177388131_177388159del |  
          | Published as | SLC34A1(NM_003052.5):c.782_810delGTGATGCTCCTGACCTGCTCAAGATCATC (p.R261Hfs*23) |  
          | ISCN | - |  
          | DB-ID | SLC34A1_000021 |  
          | Variant remarks | VKGL data sharing initiative Nederland |  
          | Reference | - |  
          | ClinVar ID | - |  
          | dbSNP ID | - |  
          | Origin | CLASSIFICATION record |  
          | Segregation | - |  
          | Frequency | - |  
          | Re-site | - |  
          | VIP | - |  
          | Methylation | - |  
          | Average frequency (gnomAD v.2.1.1) | Retrieve |  
          | Owner | VKGL-NL_VUmc |  
          | Database submission license | Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International   |  
          | Created by | VKGL-NL_VUmc |  
          | Date created | 2018-01-15 20:58:59 +01:00 (CET) |  
          | Date last edited | 2023-01-11 15:44:22 +01:00 (CET) |   
 
 
 
       
 
 Variant on transcripts
 |  
 
    Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
    Use our APIs  to retrieve data.
 |