Variant #0000302227 (NC_000005.9:g.176813234_176813254del, NM_003052.4:c.272_292del (SLC34A1))
Chromosome |
5 |
Allele |
Unknown |
Affects function (as reported) |
Does not affect function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
benign |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.176813234_176813254del |
DNA change (hg38) |
g.177386233_177386253del |
Published as |
SLC34A1(NM_003052.4):c.272_292delTCCCCAAGCTGCGCCAGGCTG (p.(Val91_Ala97del)), SLC34A1(NM_003052.5):c.272_292delTCCCCAAGCTGCGCCAGGCTG (p.V91_A97del) |
ISCN |
- |
DB-ID |
SLC34A1_000017 |
Variant remarks |
VKGL data sharing initiative Nederland |
Reference |
- |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
CLASSIFICATION record |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
VKGL-NL_Utrecht |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
VKGL-NL_Utrecht |
Date created |
2018-01-15 20:58:59 +01:00 (CET) |
Date last edited |
2024-08-28 13:16:32 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|