|   
  
    | Variant #0000302227 (NC_000005.9:g.176813234_176813254del, NM_003052.4:c.272_292del (SLC34A1))
        
          | Chromosome | 5 |  
          | Allele | Unknown |  
          | Affects function (as reported) | Does not affect function |  
          | Affects function (by curator) | Not classified |  
          | Classification method | - |  
          | Clinical classification | benign |  
          | DNA change (genomic) (Relative to hg19 / GRCh37) | g.176813234_176813254del |  
          | DNA change (hg38) | g.177386233_177386253del |  
          | Published as | SLC34A1(NM_003052.4):c.272_292delTCCCCAAGCTGCGCCAGGCTG (p.(Val91_Ala97del)), SLC34A1(NM_003052.5):c.272_292delTCCCCAAGCTGCGCCAGGCTG (p.V91_A97del) |  
          | ISCN | - |  
          | DB-ID | SLC34A1_000017 |  
          | Variant remarks | VKGL data sharing initiative Nederland |  
          | Reference | - |  
          | ClinVar ID | - |  
          | dbSNP ID | - |  
          | Origin | CLASSIFICATION record |  
          | Segregation | - |  
          | Frequency | - |  
          | Re-site | - |  
          | VIP | - |  
          | Methylation | - |  
          | Average frequency (gnomAD v.2.1.1) | Retrieve |  
          | Owner | VKGL-NL_Utrecht |  
          | Database submission license | Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International   |  
          | Created by | VKGL-NL_Utrecht |  
          | Date created | 2018-01-15 20:58:59 +01:00 (CET) |  
          | Date last edited | 2024-08-28 13:16:32 +02:00 (CEST) |   
 
 
 
       
 
 Variant on transcripts
 |  
 
    Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
    Use our APIs  to retrieve data.
 |