Variant #0000302350 (NC_000012.11:g.56583344_56583365del, NM_003075.3:c.-102_-81del (SMARCC2))
| Chromosome |
12 |
| Allele |
Unknown |
| Affects function (as reported) |
Probably does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.56583344_56583365del |
| DNA change (hg38) |
g.56189560_56189581del |
| Published as |
SMARCC2(NM_003075.5):c.-102_-81delCCGCGGCGGCGGGAGGCGGCGG |
| ISCN |
- |
| DB-ID |
SMARCC2_000002 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Utrecht |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Utrecht |
| Date created |
2018-01-15 20:58:59 +01:00 (CET) |
| Date last edited |
2021-09-17 14:40:49 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|