Variant #0000311065 (NC_000006.11:g.35478756_35478779del, NM_003322.3:c.371_394del (TULP1))
| Chromosome |
6 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.35478756_35478779del |
| DNA change (hg38) |
g.35510979_35511002del |
| Published as |
TULP1(NM_003322.5):c.371_394delACGAGGAGGACGAGGAAGAGGAGG (p.D124_E131del), TULP1(NM_003322.6):c.371_394delACGAGGAGGACGAGGAAGAGGAGG (p.D124_E131del) |
| ISCN |
- |
| DB-ID |
TULP1_000058 See all 7 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_AMC |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_AMC |
| Date created |
2018-01-15 20:58:59 +01:00 (CET) |
| Date last edited |
2023-01-11 15:44:22 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|