Variant #0000314668 (NC_000012.11:g.6442949_6442972del, NM_001065.3:c.255_278del (TNFRSF1A))
| Chromosome |
12 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.6442949_6442972del |
| DNA change (hg38) |
g.6333783_6333806del |
| Published as |
TNFRSF1A(NM_001065.3):c.255_278delGAGCGGCTCCTTCACCGCTTCAGA (p.S86_E93del) |
| ISCN |
- |
| DB-ID |
TNFRSF1A_000066 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Utrecht |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Utrecht |
| Date created |
2018-01-15 20:58:59 +01:00 (CET) |
| Date last edited |
2020-03-23 16:13:27 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|