Variant #0000336347 (NC_000009.11:g.108401920_108401921ins[AB185332.1:g.1_3062], NM_001079802.1:c.*4375_*4376ins[AB185332.1:g.1_3062] (FKTN))
Individual ID |
00151427 |
Chromosome |
9 |
Allele |
Parent #1 |
Affects function (as reported) |
Affects function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
pathogenic |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.108401920_108401921ins[AB185332.1:g.1_3062] |
DNA change (hg38) |
g.105639639_105639640ins[AB185332.1:g.1_3062] |
Published as |
- |
ISCN |
- |
DB-ID |
FKTN_000001 See all 83 reported entries |
Variant remarks |
insertion described as TCTCCC[41]; GGGAGGGAGGTGGGGGGGTCAGCCCCCCGCCTGGCCAGCCGCCCCATCC[49]; SINE; apolyadenylation signal and poly(A); target-site duplication (AAGAAAAAAAAAATTGT). |
Reference |
PubMed: Kobayashi 2001 |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
Germline |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
Johan den Dunnen |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
Johan den Dunnen |
Date created |
2006-09-17 10:45:09 +02:00 (CEST) |
Date last edited |
2021-11-03 14:11:22 +01:00 (CET) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|