Variant #0000336347 (NC_000009.11:g.108401920_108401921ins[AB185332.1:g.1_3062], NM_001079802.1:c.*4375_*4376ins[AB185332.1:g.1_3062] (FKTN))
| Individual ID |
00151427 |
| Chromosome |
9 |
| Allele |
Parent #1 |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.108401920_108401921ins[AB185332.1:g.1_3062] |
| DNA change (hg38) |
g.105639639_105639640ins[AB185332.1:g.1_3062] |
| Published as |
- |
| ISCN |
- |
| DB-ID |
FKTN_000001 See all 83 reported entries |
| Variant remarks |
insertion described as TCTCCC[41]; GGGAGGGAGGTGGGGGGGTCAGCCCCCCGCCTGGCCAGCCGCCCCATCC[49]; SINE; apolyadenylation signal and poly(A); target-site duplication (AAGAAAAAAAAAATTGT). |
| Reference |
PubMed: Kobayashi 2001 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Johan den Dunnen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2006-09-17 10:45:09 +02:00 (CEST) |
| Date last edited |
2021-11-03 14:11:22 +01:00 (CET) |

Variant on transcripts
Screenings
|