Variant #0000351285 (NC_000017.10:g.56283916_56283944del, NC_000017.10(NM_017777.3):c.1408-34_1408-6del (MKS1))
| Chromosome |
17 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.56283916_56283944del |
| DNA change (hg38) |
g.58206555_58206583del |
| Published as |
MKS1(NM_001165927.1):c.1378-34_1378-6del (p.(=)), MKS1(NM_017777.3):c.1408-34_1408-6delAGAAACCTGAGGCTGTCCCAATGGCATGC, MKS1(NM_017777.4):c.1408-34_1... |
| ISCN |
- |
| DB-ID |
MKS1_000004 See all 63 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Nijmegen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Nijmegen |
| Date created |
2018-01-15 20:58:59 +01:00 (CET) |
| Date last edited |
2024-02-26 20:06:56 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|