Variant #0000355058 (NC_000002.11:g.?, NM_000091.4:c.? (COL4A3))
| Individual ID |
00154484 |
| Chromosome |
2 |
| Allele |
Parent #2 |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.? |
| DNA change (hg38) |
- |
| Published as |
805_828delGAGCCTGGACCTCCTGGACCCTCA |
| ISCN |
- |
| DB-ID |
COL4A3_000000 |
| Variant remarks |
- |
| Reference |
PubMed: Zhang 2011 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Genomic location of variant could not be determined |
| Owner |
Johan den Dunnen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2018-02-25 12:02:06 +01:00 (CET) |
| Date last edited |
N/A |
Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|