Variant #0000356906 (NC_000001.10:g.227169795_227169820dup, NM_020247.4:c.798_823dup (ADCK3))
| Individual ID |
00154963 |
| Chromosome |
1 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.227169795_227169820dup |
| DNA change (hg38) |
g.226982094_226982119dup |
| Published as |
798_823dupGCTCTGCAAGGTGCGTGGTGCGGCAC |
| ISCN |
- |
| DB-ID |
ADCK3_000037 |
| Variant remarks |
- |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Unknown |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
IMGAG |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
IMGAG |
| Date created |
2018-03-07 04:00:41 +01:00 (CET) |
| Date last edited |
2020-06-05 19:44:54 +02:00 (CEST) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|