Genomic variant #0000394106

Individual ID 00172984
Chromosome X
Allele Unknown
Affects function (as reported) Effect unknown
Affects function (by curator) Not classified
DNA change (genomic) (Relative to hg19 / GRCh37) g.112022618_112022644del
DNA change (hg38) -
Published as 1511_1537delTTGCTGTTGCTGCTGCTGCTGCTCCAG;V504_A513>A
DB-ID AMOT_000006 See all 2 reported entries
Variant remarks variant and/or predicted effect could not be not confirmed by curators
Reference PubMed: Tarpey 2009
ClinVar ID -
dbSNP ID -
Origin Germline
Segregation -
Frequency 2/208 cases
Re-site -
Methylation -
Average frequency (large NGS studies) 0.02381 View details
Owner Lucy Raymond

Variant on transcripts



Affects function     


DNA change (cDNA)     


RNA change     

AMOT NM_133265.2 ?/. - c.1511_1537del - r.(?) p.(Val504_Pro512del)


AscendingScreening ID     





Genes screened     

Variants found     

0000173867 DNA SEQ - - ACTRT1 1 Lucy Raymond