Variant #0000394184 (NC_000023.10:g.150840695_150840715del, NM_173493.2:c.1478_1498del (PASD1))
| Individual ID |
00173060 |
| Chromosome |
X |
| Allele |
Parent #1 |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.150840695_150840715del |
| DNA change (hg38) |
g.151672223_151672243del |
| Published as |
1478_1498delAGCGGCAGCTGCGGGAGCAGC |
| ISCN |
- |
| DB-ID |
PASD1_000051 See all 2 reported entries |
| Variant remarks |
found once, nonrecurrent change |
| Reference |
PubMed: Tarpey 2009 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
1/208 cases |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Lucy Raymond |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2009-05-08 12:40:34 +02:00 (CEST) |
| Date last edited |
2018-07-27 13:19:22 +02:00 (CEST) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|