Variant #0000409086 (NC_000019.9:g.41356801_41356823delinsCAGATTCCACATATGGATT, NM_000762.5:c.-492_-470delinsAATCCATATGTGGAATCTG (CYP2A6))
| Individual ID |
00183747 |
| Chromosome |
19 |
| Allele |
Parent #1 |
| Affects function (as reported) |
Probably does not affect function |
| Affects function (by curator) |
Probably does not affect function |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.41356801_41356823delinsCAGATTCCACATATGGATT |
| DNA change (hg38) |
g.40850896_40850918delinsCAGATTCCACATATGGATT |
| Published as |
-492_-470delCCCCTTCCTGAGACCCTTAACCCinsAATCCATATGTGGAATCTG |
| ISCN |
- |
| DB-ID |
CYP2A6_000163 See all 4 reported entries |
| Variant remarks |
- |
| Reference |
PubMed: Mwenifumbo 2008 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Julia Lopez |
| Database submission license |
Creative Commons Attribution 4.0 International |
| Created by |
Julia Lopez |
| Date created |
2018-10-27 11:56:01 +02:00 (CEST) |
| Date last edited |
N/A |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|