Variant #0000461140 (NC_000015.9:g.42681136_42681156del, NM_000070.2:c.643_663del (CAPN3))
| Individual ID |
00220221 |
| Chromosome |
15 |
| Allele |
Parent #1 |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.42681136_42681156del |
| DNA change (hg38) |
g.42388938_42388958del |
| Published as |
643_663delTCCTACGAAGCTCTGAAAGGT |
| ISCN |
- |
| DB-ID |
CAPN3_000075 See all 36 reported entries |
| Variant remarks |
- |
| Reference |
PubMed: Nallamilli 2018 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Madhuri Hegde |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2019-02-06 14:15:12 +01:00 (CET) |
| Date last edited |
N/A |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|