Variant #0000464282 (NC_000008.10:g.100866422_100866441delinsTT, NM_017890.3:c.10880_10899delinsTT (VPS13B))
| Individual ID |
00226217 |
| Chromosome |
8 |
| Allele |
Maternal (confirmed) |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.100866422_100866441delinsTT |
| DNA change (hg38) |
g.99854194_99854213delinsTT |
| Published as |
10880insTTdelCTGCGAGGCAGCTTGTGCAC |
| ISCN |
- |
| DB-ID |
VPS13B_000370 See all 2 reported entries |
| Variant remarks |
- |
| Reference |
PubMed: Parri 2010, Journal: Parri 2010 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
yes |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Johan den Dunnen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2019-03-03 22:02:07 +01:00 (CET) |
| Date last edited |
N/A |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|