Variant #0000515129 (NC_000002.11:g.233712223_233712243del, KCNJ13(NM_002242.4):c.-71092_-71072del)

Chromosome 2
Allele Unknown
Affects function (as reported) Does not affect function
Affects function (by curator) Not classified
Classification method -
Clinical classification benign
DNA change (genomic) (Relative to hg19 / GRCh37) g.233712223_233712243del
DNA change (hg38) g.232847513_232847533del
Published as GIGYF2(NM_015575.3):c.3626_3646delTGCCACAGCAGCAGCAGCAGC (p.L1209_Q1215del)
ISCN -
DB-ID GIGYF2_000016 See all 2 reported entries
Variant remarks VKGL data sharing initiative Nederland
Reference -
ClinVar ID -
dbSNP ID -
Origin CLASSIFICATION record
Segregation -
Frequency -
Re-site -
VIP -
Methylation -
Average frequency (large NGS studies) Variant not found in online data sets
Owner VKGL-NL_Groningen
Options




Variant on transcripts


Gene     

AscendingTranscript     

Affects function     

Exon     

DNA change (cDNA)     

RNA change     

Protein     
GIGYF2 NM_001103146.1 -/. - c.3626_3646del r.(?) p.(Leu1209_Gln1215del)
KCNJ13 NM_002242.4 -/. - c.-71092_-71072del r.(?) p.(=)