Variant #0000515129 (NC_000002.11:g.233712223_233712243del, NM_002242.4:c.-71092_-71072del (KCNJ13))
Chromosome |
2 |
Allele |
Unknown |
Affects function (as reported) |
Does not affect function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
benign |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.233712223_233712243del |
DNA change (hg38) |
g.232847513_232847533del |
Published as |
GIGYF2(NM_001103147.2):c.3689_3709delTGCCACAGCAGCAGCAGCAGC (p.L1230_Q1236del), GIGYF2(NM_015575.4):c.3626_3646delTGCCACAGCAGCAGCAGCAGC (p.L1209_Q1...) |
ISCN |
- |
DB-ID |
GIGYF2_000016 See all 2 reported entries |
Variant remarks |
VKGL data sharing initiative Nederland |
Reference |
- |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
CLASSIFICATION record |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
VKGL-NL_Groningen |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
VKGL-NL_Groningen |
Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
Date last edited |
2023-04-16 21:50:28 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|