Variant #0000515129 (NC_000002.11:g.233712223_233712243del, NM_002242.4:c.-71092_-71072del (KCNJ13))
| Chromosome |
2 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.233712223_233712243del |
| DNA change (hg38) |
g.232847513_232847533del |
| Published as |
GIGYF2(NM_001103147.2):c.3689_3709delTGCCACAGCAGCAGCAGCAGC (p.L1230_Q1236del), GIGYF2(NM_015575.4):c.3626_3646delTGCCACAGCAGCAGCAGCAGC (p.L1209_Q1...) |
| ISCN |
- |
| DB-ID |
GIGYF2_000016 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
| Date last edited |
2023-04-16 21:50:28 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|