Variant #0000516562 (NC_000002.11:g.63660921_63660947del, NM_015910.5:c.760_786del (WDPCP))
| Chromosome |
2 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.63660921_63660947del |
| DNA change (hg38) |
g.63433787_63433813del |
| Published as |
WDPCP(NM_015910.6):c.760_786delCCCATTTCTTCTGAGAAGGACAGAGCC (p.P254_A262del), WDPCP(NM_015910.7):c.760_786del (p.(Pro254_Ala262del)), WDPCP(NM_0159...) |
| ISCN |
- |
| DB-ID |
WDPCP_000013 See all 5 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
| Date last edited |
2025-05-05 21:14:00 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|