Variant #0000523514 (NC_000004.11:g.89013403_89013425dup, NM_004827.2:c.1930_1952dup (ABCG2))
Chromosome |
4 |
Allele |
Unknown |
Affects function (as reported) |
Does not affect function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
benign |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.89013403_89013425dup |
DNA change (hg38) |
g.88092251_88092273dup |
Published as |
ABCG2(NM_004827.2):c.1930_1952dupGCCTACCTGAAATTGTTATTTCT (p.K652Pfs*3) |
ISCN |
- |
DB-ID |
ABCG2_000002 |
Variant remarks |
VKGL data sharing initiative Nederland |
Reference |
- |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
CLASSIFICATION record |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
VKGL-NL_Rotterdam |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
VKGL-NL_Rotterdam |
Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
Date last edited |
2020-06-16 13:35:10 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|