Variant #0000528049 (NC_000006.11:g.170871055_170871076del, TBP(NM_001172085.1):c.171_192del)

Chromosome 6
Allele Unknown
Affects function (as reported) Does not affect function
Affects function (by curator) Not classified
Classification method -
Clinical classification benign
DNA change (genomic) (Relative to hg19 / GRCh37) g.170871055_170871076del
DNA change (hg38) g.170561967_170561988del
Published as TBP(NM_003194.4):c.231_252delGCAGCAGCAGCAGCAGCAGCAG (p.Q77Hfs*60), TBP(NM_003194.5):c.231_252delGCAGCAGCAGCAGCAGCAGCAG (p.Q77Hfs*60)
ISCN -
DB-ID TBP_000015 See all 2 reported entries
Variant remarks VKGL data sharing initiative Nederland
Reference -
ClinVar ID -
dbSNP ID -
Origin CLASSIFICATION record
Segregation -
Frequency -
Re-site -
VIP -
Methylation -
Average frequency (gnomAD v.2.1.1) Retrieve
Owner VKGL-NL_Groningen
Database submission license Creative Commons Attribution-NonCommercial-ShareAlike 4.0 InternationalCreative Commons License
Created by VKGL-NL_Groningen
Options




Variant on transcripts


Gene     

AscendingTranscript     

Affects function     

Exon     

DNA change (cDNA)     

RNA change     

Protein     
TBP NM_001172085.1 -/. - c.171_192del r.(?) p.(Gln57HisfsTer60)
TBP NM_003194.4 -/. - c.231_252del r.(?) p.(Gln77HisfsTer60)