Variant #0000528287 (NC_000006.11:g.31902068_31902095del, NC_000006.11(NM_000063.4):c.841_849+19del (C2))
| Chromosome |
6 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.31902068_31902095del |
| DNA change (hg38) |
g.31934291_31934318del |
| Published as |
C2(NM_000063.4):c.839_849+17delTGGTGGACAGGGTCAGGAATCAGGAGTC, C2(NM_001282459.1):c.841_868delGTGGACAGGGTCAGGAATCAGGAGTCTG (p.V281Pfs*110), C2(NM_00...) |
| ISCN |
- |
| DB-ID |
C2_000014 See all 5 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Rotterdam |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Rotterdam |
| Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
| Date last edited |
2025-05-05 21:14:00 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|