Variant #0000528287 (NC_000006.11:g.31902068_31902095del, NC_000006.11(NM_000063.4):c.841_849+19del (C2))
Chromosome |
6 |
Allele |
Unknown |
Affects function (as reported) |
Affects function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
pathogenic |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.31902068_31902095del |
DNA change (hg38) |
g.31934291_31934318del |
Published as |
C2(NM_000063.4):c.839_849+17delTGGTGGACAGGGTCAGGAATCAGGAGTC, C2(NM_001282459.1):c.841_868delGTGGACAGGGTCAGGAATCAGGAGTCTG (p.V281Pfs*110), C2(NM_00...) |
ISCN |
- |
DB-ID |
C2_000014 See all 5 reported entries |
Variant remarks |
VKGL data sharing initiative Nederland |
Reference |
- |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
CLASSIFICATION record |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
VKGL-NL_Rotterdam |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
VKGL-NL_Rotterdam |
Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
Date last edited |
2025-05-05 21:14:00 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|