Variant #0000533856 (NC_000008.10:g.141445373_141445393del, NC_000008.10(NM_001160372.1):c.731-31_731-11del (TRAPPC9))
| Chromosome |
8 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.141445373_141445393del |
| DNA change (hg38) |
g.140435274_140435294del |
| Published as |
TRAPPC9(NM_031466.8):c.731-31_731-11delGGTTTTTGTTTTTTGTTTTCT |
| ISCN |
- |
| DB-ID |
TRAPPC9_000047 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
| Date last edited |
2023-01-11 15:44:22 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|