Variant #0000537643 (NC_000009.11:g.140772551_140772571dup, NM_000718.3:c.166_186dup (CACNA1B))
| Chromosome |
9 |
| Allele |
Unknown |
| Affects function (as reported) |
Probably does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.140772551_140772571dup |
| DNA change (hg38) |
g.137878099_137878119dup |
| Published as |
CACNA1B(NM_000718.3):c.166_186dupATGGCGCTGTACAACCCCATC (p.(Met56_Ile62dup)), CACNA1B(NM_000718.4):c.166_186dupATGGCGCTGTACAACCCCATC (p.M56_I62dup) |
| ISCN |
- |
| DB-ID |
CACNA1B_000042 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
| Date last edited |
2024-08-28 13:16:32 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|