Variant #0000545656 (NC_000011.9:g.71936228_71936255del, NC_000011.9(NM_001567.3):c.182+18_182+45del (INPPL1))
| Chromosome |
11 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.71936228_71936255del |
| DNA change (hg38) |
g.72225184_72225211del |
| Published as |
INPPL1(NM_001567.4):c.182+18_182+45delTCCTTGCGGGCTGGCGTGGACCGGGAGC |
| ISCN |
- |
| DB-ID |
FOLR2_000003 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_AMC |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_AMC |
| Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
| Date last edited |
2023-01-11 15:44:22 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|