Variant #0000546594 (NC_000012.11:g.111885832_111885855del, ATXN2(NM_002973.3):c.*4777_*4800del)

Chromosome 12
Allele Unknown
Affects function (as reported) Probably does not affect function
Affects function (by curator) Not classified
Classification method -
Clinical classification likely benign
DNA change (genomic) (Relative to hg19 / GRCh37) g.111885832_111885855del
DNA change (hg38) g.111448028_111448051del
Published as SH2B3(NM_005475.2):c.1454_1477delATTCAGAGTCCCTTCCTCACTGGG (p.D485_W492del)
ISCN -
DB-ID ATXN2_000033
Variant remarks VKGL data sharing initiative Nederland
Reference -
ClinVar ID -
dbSNP ID -
Origin CLASSIFICATION record
Segregation -
Frequency -
Re-site -
VIP -
Methylation -
Average frequency (gnomAD v.2.1.1) Variant not found in online data sets
Owner VKGL-NL_Utrecht
Database submission license Creative Commons Attribution-NonCommercial-ShareAlike 4.0 InternationalCreative Commons License
Created by VKGL-NL_Utrecht
Options




Variant on transcripts


Gene     

AscendingTranscript     

Affects function     

Exon     

DNA change (cDNA)     

Haplotype     

RNA change     

Protein     
ATXN2 NM_002973.3 -?/. - c.*4777_*4800del - r.(=) p.(=)
SH2B3 NM_005475.2 -?/. - c.1454_1477del - r.(?) p.(Asp485_Trp492del)