Variant #0000549074 (NC_000012.11:g.7045918_7045938del, NM_001007026.1:c.1488_1508del (ATN1))
| Chromosome |
12 |
| Allele |
Unknown |
| Affects function (as reported) |
Probably does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.7045918_7045938del |
| DNA change (hg38) |
g.6936755_6936775del |
| Published as |
ATN1(NM_001007026.2):c.1488_1508delGCAGCAGCAGCAGCAGCAGCA (p.Q496_Q502del) |
| ISCN |
- |
| DB-ID |
ATN1_000090 See all 3 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
| Date last edited |
2024-02-26 20:06:56 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|