Variant #0000549628 (NC_000013.10:g.100637714_100637743del, NM_007129.3:c.1377_1406del (ZIC2))
| Chromosome |
13 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.100637714_100637743del |
| DNA change (hg38) |
g.99985460_99985489del |
| Published as |
ZIC2(NM_007129.3):c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCGGC (p.(Ala460_Ala469del)), ZIC2(NM_007129.4):c.1377_1406delAGCGGCGGCGGCGGCTGCGGCGGCGGCG... |
| ISCN |
- |
| DB-ID |
ZIC2_000043 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Leiden |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Leiden |
| Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
| Date last edited |
2024-08-28 13:16:32 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|