Variant #0000553402 (NC_000014.8:g.92537355_92537378dup, NM_004993.5:c.892_915dup (ATXN3))
| Chromosome |
14 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.92537355_92537378dup |
| DNA change (hg38) |
g.92071011_92071034dup |
| Published as |
ATXN3(NM_004993.5):c.892_915dupCAGCAGCAGCAGCAGCAGCAGCAG (p.Q298_Q305dup), ATXN3(NM_004993.6):c.892_915dup (p.(Gln298_Gln305dup)) |
| ISCN |
- |
| DB-ID |
ATXN3_000049 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Rotterdam |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Rotterdam |
| Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
| Date last edited |
2024-04-19 20:27:30 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|