Variant #0000553624 (NC_000015.9:g.23086305_23086331dup, NM_144599.4:c.88_114dup (NIPA1))
| Chromosome |
15 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.23086305_23086331dup |
| DNA change (hg38) |
g.22786737_22786763dup |
| Published as |
NIPA1(NM_144599.4):c.88_114dupCTCGGCCTGGGCGTGGCCGTCGTGTCG (p.L30_S38dup) |
| ISCN |
- |
| DB-ID |
NIPA1_000024 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Rotterdam |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Rotterdam |
| Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
| Date last edited |
2020-03-23 16:13:27 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|