Variant #0000561491 (NC_000017.10:g.40688504_40688527dup, NM_000263.3:c.214_237dup (NAGLU))
Chromosome |
17 |
Allele |
Unknown |
Affects function (as reported) |
Affects function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
pathogenic |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.40688504_40688527dup |
DNA change (hg38) |
g.42536486_42536509dup |
Published as |
NAGLU(NM_000263.3):c.214_237dupGCGGCGCGCGTGCGGGTGCGCGGC (p.A72_G79dup) |
ISCN |
- |
DB-ID |
NAGLU_000048 See all 2 reported entries |
Variant remarks |
VKGL data sharing initiative Nederland |
Reference |
- |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
CLASSIFICATION record |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
VKGL-NL_Rotterdam |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
VKGL-NL_Rotterdam |
Date created |
2019-07-18 18:22:55 +02:00 (CEST) |
Date last edited |
2020-03-23 16:13:27 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|